View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11738_low_4 (Length: 582)

Name: NF11738_low_4
Description: NF11738
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11738_low_4
NF11738_low_4
[»] chr2 (4 HSPs)
chr2 (210-383)||(43366961-43367130)
chr2 (8-110)||(43366765-43366867)
chr2 (401-463)||(43367191-43367253)
chr2 (142-170)||(43366902-43366930)


Alignment Details
Target: chr2 (Bit Score: 141; Significance: 1e-73; HSPs: 4)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 141; E-Value: 1e-73
Query Start/End: Original strand, 210 - 383
Target Start/End: Original strand, 43366961 - 43367130
Alignment:
Q  210 ttactttcaacacagtctctaacactctgttttttcagatttcataattaaaaccaaataggagggatgcgtaaagaaatagtcgaaaatattggtttta 309  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||| ||||||||||||||||||| |||||||||||||||||||    
T  43366961 ttactttcaacacagtctctaacactctgttttttcagatttcataattcaaactaaatatgagggatgcgtaaagaaattgtcgaaaatattggtttta 43367060  T
Q  310 agcccatggactgcgagttaaacgggttgatgtgggcctcgagtcgacccatatatatacccagctctactatt 383  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||    ||||||||||||||||||||    
T  43367061 agcccatggactgcgagttaaacgggttgatgtgggcctcgagtcgaccc----atatacccagctctactatt 43367130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 95; E-Value: 3e-46
Query Start/End: Original strand, 8 - 110
Target Start/End: Original strand, 43366765 - 43366867
Alignment:
Q  8 gcagagaagaagtgattcgttcgtgaagaaatgagagaaacagaagaaaacaagggttagagataagtatgaaattcagttatgggccaaactataaatg 107  Q
    |||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  43366765 gcagagaagatgtgattcgttcgtgaagaaatgagagaaacagaacaaaacaagggttagagataagtatgaaattcagttatgggccaaactataaatg 43366864  T
Q  108 gac 110  Q
    |||    
T  43366865 gac 43366867  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 401 - 463
Target Start/End: Original strand, 43367191 - 43367253
Alignment:
Q  401 acatgggatgggatttggaaatgagtagtaattggatgcagtagttttttagcactgtaaaat 463  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  43367191 acatgggatgggatttggaaatgagtagtaattggatgcagtagtttttgagcactgtaaaat 43367253  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 142 - 170
Target Start/End: Original strand, 43366902 - 43366930
Alignment:
Q  142 taatttcttataccaccctacatcatttt 170  Q
    |||||||||||||||||||||||||||||    
T  43366902 taatttcttataccaccctacatcatttt 43366930  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University