View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11737A_low_410 (Length: 243)

Name: NF11737A_low_410
Description: NF11737A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11737A_low_410
NF11737A_low_410
[»] chr3 (2 HSPs)
chr3 (10-195)||(33262054-33262239)
chr3 (179-230)||(33261974-33262025)


Alignment Details
Target: chr3 (Bit Score: 150; Significance: 2e-79; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 10 - 195
Target Start/End: Complemental strand, 33262239 - 33262054
Alignment:
Q  10 tgaatgacccaaaatcattgagctcagctcttctgaagttgtgatgttgaaaggcagacttgctggcccttgcaatgtggcattctgcggttgcaaacta 109  Q
    ||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||    
T  33262239 tgaatgacccaaaatcattgagctcagctcttctgaaattgggatgttgaaaggcagacttgttggcccttgcagtgtggcattctgcggttgcaaacta 33262140  T
Q  110 gtcattgttgacccctccaatatggcagtttgtggttgcagatgactaattgctggcccttccaacatggcactctgtggttgcaa 195  Q
    |||||||||||||||||||||||||||||| |||||||||||| |||||||| ||||||||||||||||||| |||||||| ||||    
T  33262139 gtcattgttgacccctccaatatggcagttcgtggttgcagattactaattgatggcccttccaacatggcagtctgtggtagcaa 33262054  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 179 - 230
Target Start/End: Complemental strand, 33262025 - 33261974
Alignment:
Q  179 gcactctgtggttgcaactcagtcatcgctggcccttgcaatatcgctctct 230  Q
    ||||||||||||| ||||||||||||||||||||||||||||||||||||||    
T  33262025 gcactctgtggttccaactcagtcatcgctggcccttgcaatatcgctctct 33261974  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University