View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11737A_low_340 (Length: 250)

Name: NF11737A_low_340
Description: NF11737A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11737A_low_340
NF11737A_low_340
[»] chr1 (1 HSPs)
chr1 (11-244)||(49166154-49166387)
[»] chr8 (1 HSPs)
chr8 (12-44)||(43752585-43752617)


Alignment Details
Target: chr1 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 11 - 244
Target Start/End: Original strand, 49166154 - 49166387
Alignment:
Q  11 gagatgttattaccgcaattatgcaaagatttattacttacataccaatgcaacagataaaattgaccttttatggtatttattagtcccaaatctagaa 110  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  49166154 gagatgttattaccgcaattatgcaaagatttattacttacataccaatgcaacagataaaattgaccttttatggtatttattagtcccaaatctagaa 49166253  T
Q  111 gatagttcataggtttgaatacttttggctacaggttcacaatacctacattttccaaatactagtatgcattatgttgcttgtatattcagtttatttt 210  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  49166254 gatagttcataggtttgaatacttttggctacaggttcacaatacctacattttccaaatactagtatgcattatgttgcttgtatattcagtttatttt 49166353  T
Q  211 ctatttagtcttgttacattgttatattcttgga 244  Q
    ||||||| |||||| |||||||||| ||||||||    
T  49166354 ctatttactcttgtgacattgttattttcttgga 49166387  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 12 - 44
Target Start/End: Original strand, 43752585 - 43752617
Alignment:
Q  12 agatgttattaccgcaattatgcaaagatttat 44  Q
    |||||||||| ||||||||||||||||||||||    
T  43752585 agatgttattgccgcaattatgcaaagatttat 43752617  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University