View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1172_low_144 (Length: 261)

Name: NF1172_low_144
Description: NF1172
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1172_low_144
NF1172_low_144
[»] chr4 (2 HSPs)
chr4 (30-119)||(9498162-9498251)
chr4 (202-261)||(9498020-9498079)


Alignment Details
Target: chr4 (Bit Score: 82; Significance: 8e-39; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 30 - 119
Target Start/End: Complemental strand, 9498251 - 9498162
Alignment:
Q  30 aattgtctgacatactgagagatttcttgttcttgtgattattgttgtaaaaatcaatacatcttccaatcacatgtttacaaagtattg 119  Q
    |||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  9498251 aattgtctgacatactgaaagatttcttgttcttgagattattgttgtaaaaatcaatacatcttccaatcacatgtttacaaagtattg 9498162  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 202 - 261
Target Start/End: Complemental strand, 9498079 - 9498020
Alignment:
Q  202 agtcaattaataagatcaataacacatacacaatgtactgtgattaagtgataaagcaaa 261  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
T  9498079 agtcaattaataagatccataacacatacacaatgtactgtgattaagtgataaagcaaa 9498020  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University