View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11721_low_94 (Length: 215)

Name: NF11721_low_94
Description: NF11721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11721_low_94
NF11721_low_94
[»] chr3 (1 HSPs)
chr3 (101-199)||(54849921-54850019)


Alignment Details
Target: chr3 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 101 - 199
Target Start/End: Complemental strand, 54850019 - 54849921
Alignment:
Q  101 cgtgatgaaaccaaaaacacactaacaagtaatgttcaatgcgaaaaattgcaaagattgaagatcaaagatgaatatcaacgaaagtgatgagtaacc 199  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
T  54850019 cgtgatgaaaccaaaaacacactaacaagtaatgttcaatgcgaaaaattgcaaagattgaagatcaaagatgaatatcaacgaaagtgataagtaacc 54849921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University