View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11721_high_80 (Length: 240)

Name: NF11721_high_80
Description: NF11721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11721_high_80
NF11721_high_80
[»] chr2 (1 HSPs)
chr2 (18-80)||(1539714-1539776)


Alignment Details
Target: chr2 (Bit Score: 59; Significance: 4e-25; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 18 - 80
Target Start/End: Original strand, 1539714 - 1539776
Alignment:
Q  18 aggggcgatagacactgtaaacaaaaacaattattcatcactgtcatatcacaaacctaggat 80  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
T  1539714 aggggcgatagacactgtaaacaaaaacaattattcatcactgtcatgtcacaaacctaggat 1539776  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University