View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11721_high_71 (Length: 252)

Name: NF11721_high_71
Description: NF11721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11721_high_71
NF11721_high_71
[»] chr5 (1 HSPs)
chr5 (1-242)||(2633131-2633384)


Alignment Details
Target: chr5 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 2633131 - 2633384
Alignment:
Q  1 ccggcttcgcctttccggagagtttgcctgaatttcaatcagttaatcccttgctgctcatcagacaaatcctaccggtggtgaagttctcggag----- 95  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||         
T  2633131 ccggcttcgcctttccggagagtttgcctgaatttcaatcagttaatcccttgctgctcatcagacaaatcctaccggtggtgaagttctcggagctgga 2633230  T
Q  96 -------ctggagctggcggtggagagttgcgccgtctgcctctgtgagttcaaggcggaggatgagatccaacggctcacaaactgccgtcacattttc 188  Q
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  2633231 gctggagctggagctggcggtggagagttgcgccgtctgcctctgtgagttcaaggcggaggatgagatccaacggctcacaaactgccgtcacattttc 2633330  T
Q  189 catagaagctgcctggaccgttggatgggatatgatcacactacatgtcctttg 242  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  2633331 catagaagctgcctggaccgttggatgggatatgatcacactacatgtcctttg 2633384  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University