View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11713_high_3 (Length: 239)

Name: NF11713_high_3
Description: NF11713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11713_high_3
NF11713_high_3
[»] chr3 (1 HSPs)
chr3 (70-231)||(47458930-47459091)


Alignment Details
Target: chr3 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 70 - 231
Target Start/End: Original strand, 47458930 - 47459091
Alignment:
Q  70 ttgtatttgtagtggccagtgatacatccctgcatgagtttctcaacagctttctgcaatttagaagcaggtggtatgatttccctcaccgtggggccag 169  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  47458930 ttgtatttgtagtggccagtgatacatccctgcatgagtttctcaacagctttctgcaatttagaagcaggtggtatgatttccctcaccgtggggccag 47459029  T
Q  170 agggattgttgctggtgttatttttggagagcatgatttgagccgtcgtgttttcatgatgt 231  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  47459030 agggattgttgctggtgttatttttggagagcatgatttgagccgtcgtgttttcatgatgt 47459091  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University