View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1170_low_15 (Length: 403)

Name: NF1170_low_15
Description: NF1170
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1170_low_15
NF1170_low_15
[»] chr8 (1 HSPs)
chr8 (84-305)||(27296601-27296823)
[»] chr5 (2 HSPs)
chr5 (155-205)||(24047906-24047956)
chr5 (166-206)||(29163412-29163452)
[»] scaffold0205 (1 HSPs)
scaffold0205 (153-205)||(21451-21503)


Alignment Details
Target: chr8 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 84 - 305
Target Start/End: Original strand, 27296601 - 27296823
Alignment:
Q  84 gcaaaggt-taaatgattagcttaatgtgaacaacaaaatttctacggaaaaataggcgtgtatggtgcccgacatgtgtcagtgtctaatattgacatg 182  Q
    |||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||    
T  27296601 gcaaaggtataaatgattagcttaatgtgaacaacaaaatttctatggaaaaataggcgtgtatggtgcccgacatgtgtcactgtctaatattgacatg 27296700  T
Q  183 acacggacacatgtggttacatttcatcccttctattgtcttaaactattactagtgtctatgtgttgctatcaacgtcacatttgtgtttgtgtctgcg 282  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  27296701 acacggacacatgtggttacatttcatcccttctattgtcttaaactattactagtgtctatgtgttgctatcaacgtcacatttgtgtttgtgtctgcg 27296800  T
Q  283 tttcatagtgtgtatgaaatatc 305  Q
    |||||||||||||||||||||||    
T  27296801 tttcatagtgtgtatgaaatatc 27296823  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 35; Significance: 0.0000000001; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 155 - 205
Target Start/End: Complemental strand, 24047956 - 24047906
Alignment:
Q  155 acatgtgtcagtgtctaatattgacatgacacggacacatgtggttacatt 205  Q
    |||||| ||||||||||||||||||||||||  ||||||||| ||||||||    
T  24047956 acatgtttcagtgtctaatattgacatgacaacgacacatgtagttacatt 24047906  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 166 - 206
Target Start/End: Complemental strand, 29163452 - 29163412
Alignment:
Q  166 tgtctaatattgacatgacacggacacatgtggttacattt 206  Q
    |||||| |||||||| |||||||||||||||| ||||||||    
T  29163452 tgtctactattgacaagacacggacacatgtgattacattt 29163412  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0205 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: scaffold0205
Description:

Target: scaffold0205; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 153 - 205
Target Start/End: Complemental strand, 21503 - 21451
Alignment:
Q  153 cgacatgtgtcagtgtctaatattgacatgacacggacacatgtggttacatt 205  Q
    ||||| |||||||||| |||||||||||  |||| || |||||||||||||||    
T  21503 cgacacgtgtcagtgtttaatattgacacaacactgatacatgtggttacatt 21451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University