View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11705_low_17 (Length: 241)

Name: NF11705_low_17
Description: NF11705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11705_low_17
NF11705_low_17
[»] chr4 (1 HSPs)
chr4 (41-223)||(37879562-37879744)


Alignment Details
Target: chr4 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 41 - 223
Target Start/End: Complemental strand, 37879744 - 37879562
Alignment:
Q  41 ttgacgatgtttggacggacatcgtcgctgatggtggtgcaaaccatcttcatcatcaacaacattatcatcatccttcttctgatgaaggtttttctgc 140  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  37879744 ttgacgatgtttggacggacatcgtcgctgatggtggtgcaaaccatcttcatcatcaacaacattatcatcatccttcttctgatgaaggtttttctgc 37879645  T
Q  141 ttgcggtgccggtggtggtgatgaagttactcttgaagatttcttggtgaaagctggtgctgttccttaccctcataatcaat 223  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
T  37879644 ttgcggtgccggtggtggtgatgaagttactcttgaagatttcttggtgaaagctggtgctgttccttaccctcatcatcaat 37879562  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University