View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1169_low_83 (Length: 229)

Name: NF1169_low_83
Description: NF1169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1169_low_83
NF1169_low_83
[»] chr5 (2 HSPs)
chr5 (84-229)||(1651641-1651792)
chr5 (6-49)||(1651828-1651871)


Alignment Details
Target: chr5 (Bit Score: 113; Significance: 2e-57; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 84 - 229
Target Start/End: Complemental strand, 1651792 - 1651641
Alignment:
Q  84 cttatgaatatatcctactttagggtagtattaacatccttagctttacagattaagacattaatacagtttacttttgtatt------aagtacaataa 177  Q
    |||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||      |||||||||||    
T  1651792 cttatggatatatcttactttagggtagtattaacatccttagctttacagattaagacattaatacagtttacttttgtattatccagaagtacaataa 1651693  T
Q  178 aatagtaaaatctggaactcggtcaagaagcaagtaaagtctggccaagaat 229  Q
    |||||||||||||||||||||| |||||||||||||| ||||||||||||||    
T  1651692 aatagtaaaatctggaactcggccaagaagcaagtaaggtctggccaagaat 1651641  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 6 - 49
Target Start/End: Complemental strand, 1651871 - 1651828
Alignment:
Q  6 agttaagccatctcagagcatttactttacaatcaataggaatg 49  Q
    |||||||||||||||||| |||||||||||||||||||||||||    
T  1651871 agttaagccatctcagagtatttactttacaatcaataggaatg 1651828  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University