View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1169_high_63 (Length: 239)

Name: NF1169_high_63
Description: NF1169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1169_high_63
NF1169_high_63
[»] chr4 (2 HSPs)
chr4 (18-162)||(42234878-42235022)
chr4 (180-220)||(42235038-42235078)


Alignment Details
Target: chr4 (Bit Score: 126; Significance: 4e-65; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 18 - 162
Target Start/End: Original strand, 42234878 - 42235022
Alignment:
Q  18 atgaaggcaattcctaggtat-ctttctctttatgtgatgtaaccgggtaaattaatcaaaatcaaatcaactagaattatatattgacccgggccagta 116  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  42234878 atgaaggcaattcctaggtatactttctctttatgtgatgtaaccgggtaaattaatcaaaatcaaatcaactagaattatatattgacccgggccagta 42234977  T
Q  117 aagaaatagcaatgaattgaatgagcaatgtgtgtacaactttggt 162  Q
    |||||||||||||||| |||| ||||||||||||||||||||||||    
T  42234978 aagaaatagcaatgaa-tgaacgagcaatgtgtgtacaactttggt 42235022  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 180 - 220
Target Start/End: Original strand, 42235038 - 42235078
Alignment:
Q  180 gttcttgatatatttcaaagtgagtgatggtaagattcatt 220  Q
    ||||||||||||||||||||||| |||||||||||||||||    
T  42235038 gttcttgatatatttcaaagtgattgatggtaagattcatt 42235078  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University