View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11686_high_21 (Length: 228)

Name: NF11686_high_21
Description: NF11686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11686_high_21
NF11686_high_21
[»] chr1 (3 HSPs)
chr1 (71-228)||(41984731-41984888)
chr1 (7-58)||(41984958-41985009)
chr1 (14-58)||(41987517-41987561)


Alignment Details
Target: chr1 (Bit Score: 150; Significance: 2e-79; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 71 - 228
Target Start/End: Complemental strand, 41984888 - 41984731
Alignment:
Q  71 tatctaataaagacatggttccatgagaatataccgcacataattggtttgaacctttggtttattgaaatgccgtgttgattatgattgtccaatcgat 170  Q
    |||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  41984888 tatctaataaagacatggttccatgataatataccacacataattggtttgaacctttggtttattgaaatgccgtgttgattatgattgtccaatcgat 41984789  T
Q  171 agtgaaatacaaaaacacagcaaaaatatatacgttatttatgttttattgcaaatta 228  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  41984788 agtgaaatacaaaaacacagcaaaaatatatacgttatttatgttttattgcaaatta 41984731  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 7 - 58
Target Start/End: Complemental strand, 41985009 - 41984958
Alignment:
Q  7 atatgagtgaggaaagtacagttacaacttgcaattgacacaacatatgcag 58  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  41985009 atatgagtgaggaaagtacagttacaacttgcaattgacacaacatatgcag 41984958  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 14 - 58
Target Start/End: Complemental strand, 41987561 - 41987517
Alignment:
Q  14 tgaggaaagtacagttacaacttgcaattgacacaacatatgcag 58  Q
    |||||||||| ||||| |||||||||||||||||| | |||||||    
T  41987561 tgaggaaagtgcagttgcaacttgcaattgacacagcttatgcag 41987517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University