View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11685_high_27 (Length: 204)

Name: NF11685_high_27
Description: NF11685
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11685_high_27
NF11685_high_27
[»] chr4 (1 HSPs)
chr4 (22-186)||(19502059-19502223)


Alignment Details
Target: chr4 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 22 - 186
Target Start/End: Original strand, 19502059 - 19502223
Alignment:
Q  22 atagttttgggtaaagatggtatccacacttgtggggttactttcgatttaggtcattgttttcggactcctctcatgatccaagagaaaaccctaacat 121  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  19502059 atagttttgggtaaagatggtatccacacttgtggggttactttcgatttaggtcattgttttcggactcctctcatgatccaagagaaaaccctaacat 19502158  T
Q  122 tcctttcagatgcataaaattacataaaaatctaataatatgtatattgcccaaaatatatatct 186  Q
    ||||||  ||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||    
T  19502159 tccttttggatgcataaaattacataaaaatttaataatatgtatattgctcaaaatatatatct 19502223  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University