View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11676_low_5 (Length: 239)

Name: NF11676_low_5
Description: NF11676
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11676_low_5
NF11676_low_5
[»] chr2 (2 HSPs)
chr2 (17-63)||(11287316-11287362)
chr2 (101-143)||(11287380-11287422)


Alignment Details
Target: chr2 (Bit Score: 47; Significance: 6e-18; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 17 - 63
Target Start/End: Original strand, 11287316 - 11287362
Alignment:
Q  17 aagttctttcttttatctataaatgttacaaaatattcaaagggttg 63  Q
    |||||||||||||||||||||||||||||||||||||||||||||||    
T  11287316 aagttctttcttttatctataaatgttacaaaatattcaaagggttg 11287362  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 101 - 143
Target Start/End: Original strand, 11287380 - 11287422
Alignment:
Q  101 cccacaagttattttcattcaaagttactttctttcataatga 143  Q
    |||||||||||||||||||||||||||||||||||||||||||    
T  11287380 cccacaagttattttcattcaaagttactttctttcataatga 11287422  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University