View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11675_low_9 (Length: 285)

Name: NF11675_low_9
Description: NF11675
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11675_low_9
NF11675_low_9
[»] chr5 (1 HSPs)
chr5 (75-202)||(14003232-14003359)


Alignment Details
Target: chr5 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 75 - 202
Target Start/End: Original strand, 14003232 - 14003359
Alignment:
Q  75 ggatgaattttcctgatcggatatgaataaagttgttttgatgaaataacgtatcaattcagtgtgtgatataatgatatcaaattgaagtagtgttaac 174  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  14003232 ggatgaattttcctgatcggatatgaataaagttgttttgatgaaataacgtatcaattcagtgtgtgatataatgatatcaaattgaagtagtgttaac 14003331  T
Q  175 atgaacaactacaactagttgtcatcct 202  Q
    |||||||| |||||||| ||||||||||    
T  14003332 atgaacaattacaactatttgtcatcct 14003359  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University