View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11672_low_39 (Length: 209)

Name: NF11672_low_39
Description: NF11672
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11672_low_39
NF11672_low_39
[»] chr1 (1 HSPs)
chr1 (36-162)||(14368573-14368699)


Alignment Details
Target: chr1 (Bit Score: 111; Significance: 3e-56; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 36 - 162
Target Start/End: Complemental strand, 14368699 - 14368573
Alignment:
Q  36 aacctggatcctctgaaatcagtccaactgaatttcaaccgttgaatctagctgcaacctagctcgaatccaacatattgaaatttggttggactgactg 135  Q
    |||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  14368699 aacctggatcatctaaaatcagtccaactgaatttcaaccgttgaatctagctgcaacctagctcgaatccaacatattgaaatttggttggactgactg 14368600  T
Q  136 cacagaggatctagtgtagggtgataa 162  Q
    |||| ||||||||| ||||||||||||    
T  14368599 cacaaaggatctagggtagggtgataa 14368573  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University