View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11672_high_40 (Length: 202)

Name: NF11672_high_40
Description: NF11672
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11672_high_40
NF11672_high_40
[»] scaffold0790 (1 HSPs)
scaffold0790 (20-63)||(2818-2861)


Alignment Details
Target: scaffold0790 (Bit Score: 40; Significance: 0.00000000000007; HSPs: 1)
Name: scaffold0790
Description:

Target: scaffold0790; HSP #1
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 20 - 63
Target Start/End: Original strand, 2818 - 2861
Alignment:
Q  20 atcagttttgcaaagtaaagaggcttcaagattgtgagaggttt 63  Q
    ||||||||| ||||||||||||||||||||||||||||||||||    
T  2818 atcagttttacaaagtaaagaggcttcaagattgtgagaggttt 2861  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University