View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1166_low_83 (Length: 244)

Name: NF1166_low_83
Description: NF1166
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1166_low_83
NF1166_low_83
[»] chr7 (1 HSPs)
chr7 (51-244)||(48482594-48482787)


Alignment Details
Target: chr7 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 51 - 244
Target Start/End: Complemental strand, 48482787 - 48482594
Alignment:
Q  51 actttttcttctgaatttgctcnnnnnnnggagggcagcaaagtcatttatgtccataatcaatatatagatttttatggaagtaagcatttagttacat 150  Q
    ||||||||||||||||||||||       |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  48482787 actttttcttctgaatttgctctttttttggagggcagcaaagtcatttatgtccataatcaatatatagatttttatggaagtaagcatttagttacat 48482688  T
Q  151 ggctattacttccgctgctgggaaaatatgttgatattgtttaaatgtacagttgcgttctacagtgaagaaggggactcaaataacacagacg 244  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  48482687 ggctattacttccgctgctgggaaaatatgttgatattgtttaaatgtacagttgcgttctacagtgaagaaggggactcaaataacacagacg 48482594  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University