View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11668_low_68 (Length: 240)

Name: NF11668_low_68
Description: NF11668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11668_low_68
NF11668_low_68
[»] chr1 (1 HSPs)
chr1 (1-226)||(52153136-52153360)


Alignment Details
Target: chr1 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 52153360 - 52153136
Alignment:
Q  1 tgtatcttgcattgtgaggttgcttcaagagtttggttgtgttttgttggcctgggcttaatttattgactccaacaaatttgtaaatttatttggtttg 100  Q
    |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
T  52153360 tgtatcttgcattgtgaggttgcttcaagagtttggttgtgtttcgttggcctgggcttaatttattgactccaccaaatttgtaaatttatttggtttg 52153261  T
Q  101 gttgcatggggaaggtagaaataagaagctttgaagggnnnnnnnatactaatttggcattcaactatttgggtcgcggtttttgagtgtttaaggaagg 200  Q
    ||||||||||||||||||||||||||||||||||||||       ||||||||||||||||||||||||||||||||||||||||||||||||||| |||    
T  52153260 gttgcatggggaaggtagaaataagaagctttgaaggg-ttttttatactaatttggcattcaactatttgggtcgcggtttttgagtgtttaagggagg 52153162  T
Q  201 ctggtgttgggttggcaggttggtgt 226  Q
    ||||||||||||||||||||||||||    
T  52153161 ctggtgttgggttggcaggttggtgt 52153136  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University