View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11668_high_51 (Length: 250)

Name: NF11668_high_51
Description: NF11668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11668_high_51
NF11668_high_51
[»] chr5 (2 HSPs)
chr5 (1-139)||(1613318-1613456)
chr5 (191-240)||(1613508-1613557)


Alignment Details
Target: chr5 (Bit Score: 127; Significance: 1e-65; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 1 - 139
Target Start/End: Original strand, 1613318 - 1613456
Alignment:
Q  1 attatagaaaattagagtttgctcccttgaatgatgattgaaacatatttcactccctcttgttaaaatatttttagaagggatttatactaatatctgc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| || |||    
T  1613318 attatagaaaattagagtttgctcccttgaatgatgattgaaatatatttcactccctcttgttaaaatatttttagaagggatttatactaacatatgc 1613417  T
Q  101 accacaagtagatatagaatgaaggtcaatcaaacggtc 139  Q
    |||||||||||||||||||||||||||||||||||||||    
T  1613418 accacaagtagatatagaatgaaggtcaatcaaacggtc 1613456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 191 - 240
Target Start/End: Original strand, 1613508 - 1613557
Alignment:
Q  191 tcatacaaatgacagtttttgtgttgattttaatctcgcggcgtcctttg 240  Q
    ||||||||||||||||||| |||||||||||||||||| |||||||||||    
T  1613508 tcatacaaatgacagttttcgtgttgattttaatctcgtggcgtcctttg 1613557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University