View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11660_high_42 (Length: 242)

Name: NF11660_high_42
Description: NF11660
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11660_high_42
NF11660_high_42
[»] chr1 (1 HSPs)
chr1 (1-157)||(7101124-7101274)


Alignment Details
Target: chr1 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 1 - 157
Target Start/End: Original strand, 7101124 - 7101274
Alignment:
Q  1 ttgaggatgaaatatgagttgaattgagcaagcaagtagctgttgctcaatgtggaagtatgtaggtgatacgaagtttacaggttgaggatgaaatatg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||      ||||||||||||||||||||||||||||||||||||||||||||||    
T  7101124 ttgaggatgaaatatgagttgaattgagcaagcaagtagctgttggtc------gaagtatgtaggtgatacgaagtttacaggttgaggatgaaatatg 7101217  T
Q  101 taagtgataagaattgtgcaataatgcagtggttgttgcaccacaattactttgaag 157  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  7101218 taagtgataagaattgtgcaataatgcagtggttgttgcaccacaattactttgaag 7101274  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University