View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11655_low_78 (Length: 230)

Name: NF11655_low_78
Description: NF11655
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11655_low_78
NF11655_low_78
[»] chr2 (1 HSPs)
chr2 (39-215)||(4724205-4724380)
[»] chr1 (1 HSPs)
chr1 (50-177)||(38470460-38470589)
[»] chr6 (1 HSPs)
chr6 (158-207)||(17459208-17459257)


Alignment Details
Target: chr2 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 39 - 215
Target Start/End: Original strand, 4724205 - 4724380
Alignment:
Q  39 tcgtcggaatatgtttggtacgtgtttgttcacttttggtgttgacttgagattgggtggcagaagatttgtggccgttttgatgtggttcaatttctat 138  Q
    ||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |     
T  4724205 tcgtcggcatatgtttggtacgtgtttgttcacttttggt-ttgacttgagattgggtggcagaagatttgtggccgttttgatgtggttcaatttcaaa 4724303  T
Q  139 acccgaaagggtcagtcgatttcaaaaacccgaaagggtcgggtgttactaacgtattggaatcatcccttgatctg 215  Q
    ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
T  4724304 acccgaaagggtcagtcgatttcaaaaacccgaaatggtcgggtgttactaacgtattggaatcatcccttgatctg 4724380  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 50; Significance: 9e-20; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 50 - 177
Target Start/End: Original strand, 38470460 - 38470589
Alignment:
Q  50 tgtttggtacgtgtttgttcacttttggtgttgacttgagattgggtggcagaagatttgtggccgttttgatgtggttcaatttc-tatacccgaaagg 148  Q
    |||||||||| ||||||||  |||||| | |||||  ||||||||||||||  |||||||| | ||||||||||||||||||||||  | ||||||||||    
T  38470460 tgtttggtacatgtttgtttgcttttgttattgaccagagattgggtggcattagatttgtagtcgttttgatgtggttcaatttcaaaaacccgaaagg 38470559  T
Q  149 gtcag-tcgatttcaaaaacccgaaagggt 177  Q
    ||| |  ||||||||||||||| |||||||    
T  38470560 gtctgaccgatttcaaaaacccaaaagggt 38470589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 158 - 207
Target Start/End: Complemental strand, 17459257 - 17459208
Alignment:
Q  158 tttcaaaaacccgaaagggtcgggtgttactaacgtattggaatcatccc 207  Q
    ||||||||||||||||||||| |   |||||||||||||||| |||||||    
T  17459257 tttcaaaaacccgaaagggtctgtgattactaacgtattggactcatccc 17459208  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University