View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11655_high_64 (Length: 244)

Name: NF11655_high_64
Description: NF11655
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11655_high_64
NF11655_high_64
[»] chr5 (5 HSPs)
chr5 (41-226)||(28103113-28103308)
chr5 (160-211)||(28087754-28087805)
chr5 (160-214)||(28087573-28087627)
chr5 (160-211)||(28105788-28105839)
chr5 (160-211)||(28105957-28106008)


Alignment Details
Target: chr5 (Bit Score: 157; Significance: 1e-83; HSPs: 5)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 41 - 226
Target Start/End: Complemental strand, 28103308 - 28103113
Alignment:
Q  41 cattcttatcaccgacatcacaccacatgtacttccaaaccaattcagttttgaagaactattggaaaa----------ttcaaatcgctcaaattgttt 130  Q
    ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||          |||||||||||||||||||||    
T  28103308 cattcttatcaccgacatcacaccacatgtacttccaaaccaagtcagttttgaagaactattggaaaacgtgaccaaattcaaatcgctcaaattgttt 28103209  T
Q  131 gattccagcgaagacgaagacagatatcttggtatgcagtgcaattgtgacttcaacaagtgcatgtttcttgaatcttatcgtctctatcatgca 226  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  28103208 gattccagcgaagacgaagacagatatcttggtatgcagtgcaattgtgacttcaacaagtgcatgtttcttgaatcttatcgtctctatcatgca 28103113  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 160 - 211
Target Start/End: Original strand, 28087754 - 28087805
Alignment:
Q  160 tggtatgcagtgcaattgtgacttcaacaagtgcatgtttcttgaatcttat 211  Q
    |||||||||||||||||||||||||||||| ||||| | |||| ||||||||    
T  28087754 tggtatgcagtgcaattgtgacttcaacaactgcatatgtcttcaatcttat 28087805  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 160 - 214
Target Start/End: Original strand, 28087573 - 28087627
Alignment:
Q  160 tggtatgcagtgcaattgtgacttcaacaagtgcatgtttcttgaatcttatcgt 214  Q
    |||||||||||||||||||||||||||||| ||||  | |||| |||||||||||    
T  28087573 tggtatgcagtgcaattgtgacttcaacaactgcacatgtcttaaatcttatcgt 28087627  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 160 - 211
Target Start/End: Complemental strand, 28105839 - 28105788
Alignment:
Q  160 tggtatgcagtgcaattgtgacttcaacaagtgcatgtttcttgaatcttat 211  Q
    |||||||||||||||||||||||||||||| ||||  | |||| ||||||||    
T  28105839 tggtatgcagtgcaattgtgacttcaacaactgcacatgtcttcaatcttat 28105788  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 160 - 211
Target Start/End: Complemental strand, 28106008 - 28105957
Alignment:
Q  160 tggtatgcagtgcaattgtgacttcaacaagtgcatgtttcttgaatcttat 211  Q
    |||||||||||||||||||||||||||||| ||||  | |||| ||||||||    
T  28106008 tggtatgcagtgcaattgtgacttcaacaactgcacatgtcttaaatcttat 28105957  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University