View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11654_low_35 (Length: 257)

Name: NF11654_low_35
Description: NF11654
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11654_low_35
NF11654_low_35
[»] chr2 (2 HSPs)
chr2 (159-250)||(19588174-19588265)
chr2 (1-59)||(19588365-19588423)


Alignment Details
Target: chr2 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 159 - 250
Target Start/End: Complemental strand, 19588265 - 19588174
Alignment:
Q  159 ggtcacacataagttgaaatatcactattattaacataagtactcttaagtagcaatgtttaaatttggatgtaaattggacttctctgctt 250  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
T  19588265 ggtcacacataagttgaaatatcactattattaacataagtactcttaagtagcaatgtttaaatttggatgcaaattggacttctctgctt 19588174  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 19588423 - 19588365
Alignment:
Q  1 aatagttgattcacctgtatatatagaaacacctcaatatataaagaaattcgcatggg 59  Q
    ||||||||||||||||| ||||||||||||||||||||||||||| || ||||||||||    
T  19588423 aatagttgattcacctgaatatatagaaacacctcaatatataaataatttcgcatggg 19588365  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University