View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11651_high_62 (Length: 271)

Name: NF11651_high_62
Description: NF11651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11651_high_62
NF11651_high_62
[»] chr4 (1 HSPs)
chr4 (114-253)||(4387972-4388111)


Alignment Details
Target: chr4 (Bit Score: 136; Significance: 5e-71; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 114 - 253
Target Start/End: Original strand, 4387972 - 4388111
Alignment:
Q  114 tgcttctgtaaagaacttgttcctcggcttactatgttttgctttctccatgattcaacaaattgtttgattggagtcacaaaggaaggcagagcgacac 213  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
T  4387972 tgcttctgtaaagaacttgttcctcggcttactatgttttgctttctccatgattaaacaaattgtttgattggagtcacaaaggaaggcagagcgacac 4388071  T
Q  214 aaatcaacacaatcattgatgagatgataggatcaacaaa 253  Q
    ||||||||||||||||||||||||||||||||||||||||    
T  4388072 aaatcaacacaatcattgatgagatgataggatcaacaaa 4388111  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University