View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11650_high_27 (Length: 209)

Name: NF11650_high_27
Description: NF11650
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11650_high_27
NF11650_high_27
[»] chr1 (3 HSPs)
chr1 (13-140)||(14905129-14905257)
chr1 (67-140)||(14888338-14888412)
chr1 (163-193)||(14905077-14905107)


Alignment Details
Target: chr1 (Bit Score: 89; Significance: 4e-43; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 89; E-Value: 4e-43
Query Start/End: Original strand, 13 - 140
Target Start/End: Complemental strand, 14905257 - 14905129
Alignment:
Q  13 gcatagggaagcccagttacgtaatactcactcaaatggtaggnnnnnnnn-ggtagaaaacctaatgagaaaagtttttcttttctttccattgttttt 111  Q
    |||||||||||||||||||||||||||||||||||||||||||         |||||||||||||||||| ||| |||||||||||||||||||||||||    
T  14905257 gcatagggaagcccagttacgtaatactcactcaaatggtaggaaaaaaaatggtagaaaacctaatgaggaaaatttttcttttctttccattgttttt 14905158  T
Q  112 tctattaatgggttaggcttatccctcac 140  Q
    |||||||||||||||||||||||||||||    
T  14905157 tctattaatgggttaggcttatccctcac 14905129  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 55; E-Value: 8e-23
Query Start/End: Original strand, 67 - 140
Target Start/End: Complemental strand, 14888412 - 14888338
Alignment:
Q  67 agaaaacctaatgagaaaagttttt-cttttctttccattgttttttctattaatgggttaggcttatccctcac 140  Q
    ||||||||||||||| ||  ||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
T  14888412 agaaaacctaatgaggaattttttttcttttctttccattgttttttctattaatgggttaggcttatccctcac 14888338  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 163 - 193
Target Start/End: Complemental strand, 14905107 - 14905077
Alignment:
Q  163 atcttaagtaaatatttagcttaggaatact 193  Q
    |||||||||||||||||||||||||||||||    
T  14905107 atcttaagtaaatatttagcttaggaatact 14905077  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University