View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11630_high_8 (Length: 316)

Name: NF11630_high_8
Description: NF11630
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11630_high_8
NF11630_high_8
[»] chr1 (2 HSPs)
chr1 (174-299)||(40681940-40682065)
chr1 (243-298)||(34706824-34706877)


Alignment Details
Target: chr1 (Bit Score: 110; Significance: 2e-55; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 174 - 299
Target Start/End: Complemental strand, 40682065 - 40681940
Alignment:
Q  174 attgagaagtggttaacttatattctgaaaactttcattttatttattctttaaccaaaactcttggtgcattcatcagcaaaaacccaactagatcaag 273  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||| ||||||||||||||    
T  40682065 attgaaaagtggttaacttatattctgaaaactttcattttatttattctttaatcaaaactcttggtgcattcatcaggaaaaatccaactagatcaag 40681966  T
Q  274 taaattagaacttcatggagagaatt 299  Q
    ||||||||||||||||||||||||||    
T  40681965 taaattagaacttcatggagagaatt 40681940  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 243 - 298
Target Start/End: Complemental strand, 34706877 - 34706824
Alignment:
Q  243 cattcatcagcaaaaacccaactagatcaagtaaattagaacttcatggagagaat 298  Q
    ||||||||||||||| |||||||||||||||||||||||| ||| |||||||||||    
T  34706877 cattcatcagcaaaa-cccaactagatcaagtaaattagatctt-atggagagaat 34706824  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University