View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11626_low_35 (Length: 247)

Name: NF11626_low_35
Description: NF11626
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11626_low_35
NF11626_low_35
[»] chr8 (2 HSPs)
chr8 (147-237)||(8892854-8892944)
chr8 (1-93)||(8892722-8892815)


Alignment Details
Target: chr8 (Bit Score: 87; Significance: 8e-42; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 147 - 237
Target Start/End: Original strand, 8892854 - 8892944
Alignment:
Q  147 ttcaagattttttcttacacttgtttgtactttatattcttccatatcttagtcaaatgaaaagattacacaattataatcatgcaattca 237  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
T  8892854 ttcaagattttttcttacacttgtttgtactttatattcttccatatcttagtcaaatgaaaatattacacaattataatcatgcaattca 8892944  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 1 - 93
Target Start/End: Original strand, 8892722 - 8892815
Alignment:
Q  1 catcaaacacttgtactaa-cctaaatggtggtttcccatactcgtcacattgcacaatgtgtggctttaagtactttataaccatcttgtctt 93  Q
    ||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  8892722 catcaaacacttgtactaaacctaaatggtgttttcccatactcgtcacattgcacaatgtgtggctttaagtactttataaccatcttgtctt 8892815  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University