View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11625_low_62 (Length: 222)

Name: NF11625_low_62
Description: NF11625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11625_low_62
NF11625_low_62
[»] chr6 (1 HSPs)
chr6 (1-71)||(13179502-13179572)
[»] chr5 (2 HSPs)
chr5 (1-68)||(32373680-32373747)
chr5 (1-68)||(32409716-32409783)
[»] chr3 (1 HSPs)
chr3 (126-195)||(1424060-1424132)


Alignment Details
Target: chr6 (Bit Score: 67; Significance: 6e-30; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 1 - 71
Target Start/End: Original strand, 13179502 - 13179572
Alignment:
Q  1 agatgacactgtttatgttactgtcaaatcggtaatgcattttgttggaactgtttttgcaattaattata 71  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
T  13179502 agatgacactgtttatgttgctgtcaaatcggtaatgcattttgttggaactgtttttgcaattaattata 13179572  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 56; Significance: 2e-23; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 32373747 - 32373680
Alignment:
Q  1 agatgacactgtttatgttactgtcaaatcggtaatgcattttgttggaactgtttttgcaattaatt 68  Q
    ||||||||||||||||| | |||| |||||||||||||||||||||||||||||||||||||||||||    
T  32373747 agatgacactgtttatgatgctgtgaaatcggtaatgcattttgttggaactgtttttgcaattaatt 32373680  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 32409783 - 32409716
Alignment:
Q  1 agatgacactgtttatgttactgtcaaatcggtaatgcattttgttggaactgtttttgcaattaatt 68  Q
    ||||||||||||||||| | ||||||||||||||||||||||||||||||||| ||||||||||||||    
T  32409783 agatgacactgtttatgatgctgtcaaatcggtaatgcattttgttggaactggttttgcaattaatt 32409716  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 126 - 195
Target Start/End: Complemental strand, 1424132 - 1424060
Alignment:
Q  126 aaaatattatatatgactagtatcatc---attgatattttatattgtatgatcctacgcatgatggacttct 195  Q
    ||||||||||||||||||| ||| |||   | ||||||||||| ||||| ||||||| |||||||||||||||    
T  1424132 aaaatattatatatgactaatatgatcggcactgatattttatgttgtaagatcctatgcatgatggacttct 1424060  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University