View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11601_low_11 (Length: 216)

Name: NF11601_low_11
Description: NF11601
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11601_low_11
NF11601_low_11
[»] chr1 (1 HSPs)
chr1 (16-216)||(42169710-42169910)


Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 16 - 216
Target Start/End: Complemental strand, 42169910 - 42169710
Alignment:
Q  16 gaacaaaaaacggacctgtttgcagactgtgttataaagatctttcggggaaactccaccctgcacaagctggttaaacacatcatcacaagattttgaa 115  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  42169910 gaacgaaaaacggacctgtttgcagactgtgttataaagatctttcggggaaactccaccctgcacaagctggttaaacacatcatcacaagattttgaa 42169811  T
Q  116 atttgtgccatattccctcctttacgaaccctgtgaaaatgtaatttctgttagagattaccattaccctacgtaggccctgtttggataaacaacttaa 215  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  42169810 atttgtgccatattccctcctttacgaaccctgtgaacatgtaatttctgttagagattaccattaccctacgtaggccctgtttggataaacaacttaa 42169711  T
Q  216 t 216  Q
    |    
T  42169710 t 42169710  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University