View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1159_low_44 (Length: 251)

Name: NF1159_low_44
Description: NF1159
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1159_low_44
NF1159_low_44
[»] chr5 (1 HSPs)
chr5 (79-251)||(673770-673939)
[»] chr2 (1 HSPs)
chr2 (50-80)||(41838310-41838340)


Alignment Details
Target: chr5 (Bit Score: 102; Significance: 9e-51; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 79 - 251
Target Start/End: Complemental strand, 673939 - 673770
Alignment:
Q  79 aatttgaaatataaaaatcaatggcgttggtatctgtgnnnnnnnnncatcaatggtgttggtagacgaaggtgtgtgtgccattgccacgaaattaaat 178  Q
    ||||||||||||||||||||||||||||||||||||||         ||||||||||||||||||||||||||||||||| ||||||||||||||         
T  673939 aatttgaaatataaaaatcaatggcgttggtatctgtggaaaaaaa-catcaatggtgttggtagacgaaggtgtgtgtggcattgccacgaaat----- 673846  T
Q  179 gcaaagaggttgaaagggatg---gaactgatgctatgcaatgctcctgatttaaccacatttaggaattatcagt 251  Q
    |||||||||||||||||||||   |||||||||||||||||||||||||||||||| |||||||||||||||||||    
T  673845 gcaaagaggttgaaagggatgaatgaactgatgctatgcaatgctcctgatttaacaacatttaggaattatcagt 673770  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 50 - 80
Target Start/End: Complemental strand, 41838340 - 41838310
Alignment:
Q  50 atcaacaaaaaggttactattaatcaaacaa 80  Q
    |||||||||||||||||||||||||||||||    
T  41838340 atcaacaaaaaggttactattaatcaaacaa 41838310  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University