View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1159_high_39 (Length: 216)

Name: NF1159_high_39
Description: NF1159
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1159_high_39
NF1159_high_39
[»] chr2 (1 HSPs)
chr2 (11-99)||(7384501-7384589)


Alignment Details
Target: chr2 (Bit Score: 81; Significance: 3e-38; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 11 - 99
Target Start/End: Original strand, 7384501 - 7384589
Alignment:
Q  11 acaaactacaactatgccacgtgtacgatgaccaatagaggagtttgcaagtacaatggtaataataatcatattaagtagcctatgat 99  Q
    |||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||    
T  7384501 acaaactacaactatgccacgtgtacgatgaccaatagagaagcttgcaagtacaatggtaataataatcatattaagtagcctatgat 7384589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University