View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11592_high_28 (Length: 213)

Name: NF11592_high_28
Description: NF11592
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11592_high_28
NF11592_high_28
[»] chr3 (1 HSPs)
chr3 (101-202)||(32902062-32902168)


Alignment Details
Target: chr3 (Bit Score: 75; Significance: 1e-34; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 101 - 202
Target Start/End: Original strand, 32902062 - 32902168
Alignment:
Q  101 tagtcacctaattctggttacacc-----atgacaaaaatatccataattaaaatttaattccaaatttcaccaaaataaaaccctttcaatcgttctct 195  Q
    ||||||||||||||||||||||||     |||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
T  32902062 tagtcacctaattctggttacaccttgaaatgagaaaaatatccataattaaaatttaattcccaatttcaccaaaataaaaccctttcaatcgttctct 32902161  T
Q  196 gcttctc 202  Q
    | |||||    
T  32902162 gattctc 32902168  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University