View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11588_high_5 (Length: 314)

Name: NF11588_high_5
Description: NF11588
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11588_high_5
NF11588_high_5
[»] chr2 (1 HSPs)
chr2 (1-305)||(4885034-4885338)


Alignment Details
Target: chr2 (Bit Score: 297; Significance: 1e-167; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 297; E-Value: 1e-167
Query Start/End: Original strand, 1 - 305
Target Start/End: Original strand, 4885034 - 4885338
Alignment:
Q  1 tactgttactgttaccgttacttctactgttgtttgttaatattctctcgttttgttcttttcttttctttcttaccgacgagtttttgctatgacggtg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  4885034 tactgttactgttaccgttacttctactgttgtttgttaatattctctcgttttgttcttttcttttctttcttaccgacgagtttttgctatgacggtg 4885133  T
Q  101 attatttttatccggtggtggcggtgtagggagaggcatgaggaagtaaatcttaccgcgttgaagatcagcatcgggagggacaacaacgatcttagga 200  Q
    |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  4885134 attatttttatccggtggtggcggcgtagggagaggcatgaggaagtaaatcttaccgcgttgaagatcagcatcgggagggacaacaacgatcttagga 4885233  T
Q  201 acaactccgccatcttgtgttgaaggtgaagaaggtttcttgagaacatgttttgggtatgttttcatgatttcacttgctttgatgctgccactgattt 300  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  4885234 acaacaccgccatcttgtgttgaaggtgaagaaggtttcttgagaacatgttttgggtatgttttcatgatttcacttgctttgatgctgccactgattt 4885333  T
Q  301 cttct 305  Q
    |||||    
T  4885334 cttct 4885338  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University