View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11581_low_64 (Length: 219)

Name: NF11581_low_64
Description: NF11581
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11581_low_64
NF11581_low_64
[»] chr2 (1 HSPs)
chr2 (17-201)||(11285294-11285477)


Alignment Details
Target: chr2 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 17 - 201
Target Start/End: Complemental strand, 11285477 - 11285294
Alignment:
Q  17 tgaaatgcttccaagtggttttcttattagaccatgcgaggggggtggatccattattcatattgttgatcacgtggatttagatgtaaggggcatattt 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
T  11285477 tgaaatgcttccaagtggttttcttattagaccatgcgaggggggtggatccattattcatattgttgatcacgtggatttagatgtaaggggtatattt 11285378  T
Q  117 aatttcagatttgtttcgtaacttactgttgaacttttctgactttagtatttaacatttttctttcaggtttggagtgtccctg 201  Q
    ||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||    
T  11285377 aatttcaaatttgtttcgtaacttactgttgaacttttctgacttcagtatttaacattttt-tttcaggtttggagtgtccctg 11285294  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University