View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11581_low_49 (Length: 253)

Name: NF11581_low_49
Description: NF11581
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11581_low_49
NF11581_low_49
[»] chr3 (1 HSPs)
chr3 (11-253)||(36356978-36357230)


Alignment Details
Target: chr3 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 11 - 253
Target Start/End: Complemental strand, 36357230 - 36356978
Alignment:
Q  11 cacagaaccaagttcatcaatgaaacaaaacccctctcaatttcacatctcagnnnnnnnnnn----------gttaaccctccagttctcaggtggaat 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||                    |||||||||||||||||||||||||||    
T  36357230 cacagaaccaagttcatcaatgaaacaaaacccctctcaatttcacatctcagttttttttgtttttctttttgttaaccctccagttctcaggtggaat 36357131  T
Q  101 gagaccctagtattccagagttcgaccaggaggtacaaagtctaaccgacgattgttccacccaggaatcaaactctgttttttccatgattacatctca 200  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
T  36357130 gagaccctagtattccagagttcgaccagaaggtacaaagtctaaccgacgattgttccacccaggaatcaaactctgtttttcccatgattacatctca 36357031  T
Q  201 aagtttttgtttttcaaacaaataattaaacaaatacatgatcatccaataac 253  Q
    |||||||| ||||| |||||||||||||||||||| |||||||||||||||||    
T  36357030 aagttttttttttttaaacaaataattaaacaaatgcatgatcatccaataac 36356978  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University