View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11581_low_48 (Length: 266)

Name: NF11581_low_48
Description: NF11581
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11581_low_48
NF11581_low_48
[»] chr7 (2 HSPs)
chr7 (18-57)||(7167108-7167147)
chr7 (224-255)||(7167390-7167421)


Alignment Details
Target: chr7 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 18 - 57
Target Start/End: Original strand, 7167108 - 7167147
Alignment:
Q  18 ataaaaactagtcgatctactacatttgttccactcaaac 57  Q
    ||||||||||||||||||||||||||||||||||||||||    
T  7167108 ataaaaactagtcgatctactacatttgttccactcaaac 7167147  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 224 - 255
Target Start/End: Original strand, 7167390 - 7167421
Alignment:
Q  224 gatttgcaatgggtgtaatatctttccttcat 255  Q
    ||||||||||||||||||||||||||||||||    
T  7167390 gatttgcaatgggtgtaatatctttccttcat 7167421  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University