View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11581_high_61 (Length: 203)

Name: NF11581_high_61
Description: NF11581
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11581_high_61
NF11581_high_61
[»] chr1 (1 HSPs)
chr1 (10-130)||(4194990-4195110)


Alignment Details
Target: chr1 (Bit Score: 117; Significance: 8e-60; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 117; E-Value: 8e-60
Query Start/End: Original strand, 10 - 130
Target Start/End: Complemental strand, 4195110 - 4194990
Alignment:
Q  10 agagtgtgagaatgtgtgtggtgctttgagttgtttttgtagggagggaagtaagtaggaagtaatgattttgtgacacattaggtggggacaggtcaat 109  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  4195110 agagtgtgagaatgtgtgtgatgctttgagttgtttttgtagggagggaagtaagtaggaagtaatgattttgtgacacattaggtggggacaggtcaat 4195011  T
Q  110 caggtaaactaggccctacta 130  Q
    |||||||||||||||||||||    
T  4195010 caggtaaactaggccctacta 4194990  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University