View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11577_high_42 (Length: 239)

Name: NF11577_high_42
Description: NF11577
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11577_high_42
NF11577_high_42
[»] chr1 (2 HSPs)
chr1 (1-137)||(31949153-31949289)
chr1 (193-222)||(31949348-31949377)


Alignment Details
Target: chr1 (Bit Score: 133; Significance: 3e-69; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 1 - 137
Target Start/End: Original strand, 31949153 - 31949289
Alignment:
Q  1 taaactcaaactaatgtcattaactagcatccctatcaacccaatctttcccaaactaacaactatatttcacccgatgtgaagtaataatcacctaatc 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
T  31949153 taaactcaaactaatgtcattaactagcatccctatcaacccaatcttacccaaactaacaactatatttcacccgatgtgaagtaataatcacctaatc 31949252  T
Q  101 aattgtagtattgtgcgtaataaacagtaaaaaaacc 137  Q
    |||||||||||||||||||||||||||||||||||||    
T  31949253 aattgtagtattgtgcgtaataaacagtaaaaaaacc 31949289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 193 - 222
Target Start/End: Original strand, 31949348 - 31949377
Alignment:
Q  193 tctgctaatcccgtgtgttttgatttagac 222  Q
    ||||||||||||||||||||||||||||||    
T  31949348 tctgctaatcccgtgtgttttgatttagac 31949377  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University