View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11575_high_50 (Length: 242)

Name: NF11575_high_50
Description: NF11575
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11575_high_50
NF11575_high_50
[»] chr7 (1 HSPs)
chr7 (1-91)||(30077247-30077337)
[»] chr3 (1 HSPs)
chr3 (196-226)||(41957624-41957654)


Alignment Details
Target: chr7 (Bit Score: 87; Significance: 8e-42; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 30077247 - 30077337
Alignment:
Q  1 caagtcacacatctagatttccaaatttacatgactgtggcaaataatttatccaaataaacacaatggagttaaccttcaatggtttact 91  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||    
T  30077247 caagtcacacatctagatttccaaatttacatgactgtggcaaataatttatccaaataaacacaatagagttaaccttcaatggtttact 30077337  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 196 - 226
Target Start/End: Original strand, 41957624 - 41957654
Alignment:
Q  196 gaccaatgaaaagtgagaaaaaagaaattat 226  Q
    |||||||||||||||||||||||||||||||    
T  41957624 gaccaatgaaaagtgagaaaaaagaaattat 41957654  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University