View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11564_low_34 (Length: 215)

Name: NF11564_low_34
Description: NF11564
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11564_low_34
NF11564_low_34
[»] chr4 (1 HSPs)
chr4 (20-199)||(43636593-43636772)


Alignment Details
Target: chr4 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 20 - 199
Target Start/End: Original strand, 43636593 - 43636772
Alignment:
Q  20 ttcataaaatattgtttggcctatagcgcatgggtaaatgtaccaaatcatggttcagaataaatactcaaccactgacaaccttgaagaacaaggccaa 119  Q
    |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  43636593 ttcataaaatattgtttggcctatagtgcatgggtaaatgtaccaaatcatggttcagaataaatactcaaccactgacaaccttgaagaacaaggccaa 43636692  T
Q  120 gggacatggagcattaccatgctatcatcataatcaaatttcacagcttctccgtcaatcatacaacttaccggcttctc 199  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  43636693 gggacatggagcattaccatgctatcatcataatcaaatttcacagcttctccgtcaatcatacaacttaccggcttctc 43636772  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University