View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11561_low_30 (Length: 201)

Name: NF11561_low_30
Description: NF11561
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11561_low_30
NF11561_low_30
[»] chr2 (1 HSPs)
chr2 (70-192)||(38879305-38879426)


Alignment Details
Target: chr2 (Bit Score: 79; Significance: 4e-37; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 70 - 192
Target Start/End: Complemental strand, 38879426 - 38879305
Alignment:
Q  70 ctcttcattgtgtgtgagcctccagcatgggtatgaccgtcatgagtctaagaaaaattaagatgacattaaaaatcataaacgtgcgtgcgcgcgcgtt 169  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||| || ||||||||||||||| | ||| ||| ||||| |||    
T  38879426 ctcttcattgtgtgtgagcctccagcatgggtatgaccgacatgagtctaacaaaaattaaaat-acattaaaaatcatatatgtgtgtgtgcgcgtgtt 38879328  T
Q  170 tgagtgtgtgtaggtgtctgtgc 192  Q
    ||||||||||| |||||||||||    
T  38879327 tgagtgtgtgtgggtgtctgtgc 38879305  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University