View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11558_low_22 (Length: 311)

Name: NF11558_low_22
Description: NF11558
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11558_low_22
NF11558_low_22
[»] chr5 (1 HSPs)
chr5 (1-95)||(27701313-27701407)
[»] chr1 (1 HSPs)
chr1 (215-311)||(47320254-47320351)


Alignment Details
Target: chr5 (Bit Score: 66; Significance: 4e-29; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 1 - 95
Target Start/End: Complemental strand, 27701407 - 27701313
Alignment:
Q  1 cattttctcttttgctagttccaatgttatgtacattgtttttctttaatctcnnnnnnnattgacaattaatattctttaatcttggcatgtga 95  Q
    |||||||||||||||||||||||||||||||| ||||||||||||||||||||       ||||| |||||||||||||||||||||||||||||    
T  27701407 cattttctcttttgctagttccaatgttatgtgcattgtttttctttaatctctttttttattgaaaattaatattctttaatcttggcatgtga 27701313  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 42; Significance: 0.000000000000007; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 215 - 311
Target Start/End: Original strand, 47320254 - 47320351
Alignment:
Q  215 agtgcgaattctttcaactataca-tttacatcctgtacataatgcttgaatccgatggtattttcgtagcataactcatcttgaaatcttcgttctt 311  Q
    |||||||||||||| ||||||||| ||||||||  || ||||  | ||||||| |||||||||||| ||||| ||||||||||||||| |||| ||||    
T  47320254 agtgcgaattctttaaactatacactttacatcaagtgcatagagattgaatcagatggtattttcatagcacaactcatcttgaaattttcgatctt 47320351  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University