View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11557A_low_323 (Length: 238)

Name: NF11557A_low_323
Description: NF11557A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11557A_low_323
NF11557A_low_323
[»] chr5 (1 HSPs)
chr5 (12-126)||(2623262-2623370)


Alignment Details
Target: chr5 (Bit Score: 92; Significance: 8e-45; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 12 - 126
Target Start/End: Complemental strand, 2623370 - 2623262
Alignment:
Q  12 ttggagagcaataatcaggtaccttttttactagactaacaacggcggaggagtcaacttcaacttcaacgagaagagaataaatagaaaaacttttatt 111  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||      ||||||||||||||||||||||||||||||||||    
T  2623370 ttggagagcaataatcaggtaccttttttactagactaacaacggcggaggagtcaactt------caacgagaagagaataaatagaaaaacttttatt 2623277  T
Q  112 gagcttcaagccaag 126  Q
    |||||||||||||||    
T  2623276 gagcttcaagccaag 2623262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University