View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11557A_low_289 (Length: 245)

Name: NF11557A_low_289
Description: NF11557A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11557A_low_289
NF11557A_low_289
[»] chr4 (1 HSPs)
chr4 (59-170)||(43921985-43922096)


Alignment Details
Target: chr4 (Bit Score: 104; Significance: 6e-52; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 59 - 170
Target Start/End: Original strand, 43921985 - 43922096
Alignment:
Q  59 tagaatcgacaagatactagtggtgcaattacggattctaatgcgatcgatgataataagagaggtgaaatgaataaaaaaggagatagaaattgaaacc 158  Q
    ||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  43921985 tagaatcgataagatactagtggtgcaattacggattctagtgcgatcgatgataataagagaggtgaaatgaataaaaaaggagatagaaattgaaacc 43922084  T
Q  159 ttgattttcatc 170  Q
    ||||||||||||    
T  43922085 ttgattttcatc 43922096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University