View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11554_low_23 (Length: 219)

Name: NF11554_low_23
Description: NF11554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11554_low_23
NF11554_low_23
[»] chr1 (1 HSPs)
chr1 (1-200)||(38246277-38246476)


Alignment Details
Target: chr1 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 200
Target Start/End: Complemental strand, 38246476 - 38246277
Alignment:
Q  1 aggagtactggaagaagaatcggaggaagagtcgttggagggttgaggaggggagaattgacgaagttgtcctttggtgatgccggagacgttggtggcg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  38246476 aggagtactggaagaagaatcggaggaagagtcgttggagggttgaggaggggagaattgacgaagttgtcctttggtgatgccggagacgttggtggcg 38246377  T
Q  101 gagagaagagcggttttaattagggtttcgaaatctgaagttctggcgggtaatgaacgtttggcatattcgttagcgattaaagtgagaccgttgaata 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  38246376 gagagaagagcggttttaattagggtttcgaaatctgaagttctggcgggtaatgaacgtttggcatattcgttagcgattaaagtgagaccgttgaata 38246277  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University