View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11550_low_19 (Length: 214)

Name: NF11550_low_19
Description: NF11550
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11550_low_19
NF11550_low_19
[»] chr1 (2 HSPs)
chr1 (17-197)||(38139598-38139779)
chr1 (74-123)||(38117466-38117515)


Alignment Details
Target: chr1 (Bit Score: 149; Significance: 7e-79; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 17 - 197
Target Start/End: Complemental strand, 38139779 - 38139598
Alignment:
Q  17 aggcaagttcaaaacagtattacatttaggggnnnnnnn-ggttggtcctgtttagggggactattactgcatctttttaccatgcagcacttgtaaaat 115  Q
    ||||||||||||||||||||||||||||||||        ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  38139779 aggcaagttcaaaacagtattacatttagggggaaaaaaaggttggtcctgtttagggggactattactgcatctttttaccatgcagcacttgtaaaat 38139680  T
Q  116 tcaagaaaacgttggtcctgattctgaaatgccgtccctaaaattaaaatgcaccggatttatgtctttactattaccacac 197  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  38139679 tcaagaaaacgttggtcctgtttctgaaatgccgtccctaaaattaaaatgcaccggatttatgtctttactattaccacac 38139598  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 74 - 123
Target Start/End: Complemental strand, 38117515 - 38117466
Alignment:
Q  74 ggactattactgcatctttttaccatgcagcacttgtaaaattcaagaaa 123  Q
    |||||| ||||||||||||||||||||||||||||  | |||||||||||    
T  38117515 ggactactactgcatctttttaccatgcagcacttacagaattcaagaaa 38117466  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University