View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1154_low_22 (Length: 320)

Name: NF1154_low_22
Description: NF1154
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1154_low_22
NF1154_low_22
[»] chr5 (1 HSPs)
chr5 (98-289)||(14281385-14281582)


Alignment Details
Target: chr5 (Bit Score: 140; Significance: 3e-73; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 140; E-Value: 3e-73
Query Start/End: Original strand, 98 - 289
Target Start/End: Original strand, 14281385 - 14281582
Alignment:
Q  98 cactgaacaaatcgctccttacttggccatgttttttgccggtaacttcacactcgtcgctctttcttcatccattttatgtttgttaagctcatctcat 197  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||    
T  14281385 cactgaacaaatcgctccttacttggccatgttttttgccggtaacttcacactcattgctctttcttcatccattttatgtttgttaagctcatctcat 14281484  T
Q  198 ctc------nnnnnnnnnaggttgctttggcctcacactcctaagttgcttcttcatttaccgggtattagagtttcacattattccttttcattcat 289  Q
    |||               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  14281485 ctcatctcttttttttttaggttgctttggcctcacactcctaagttgcttcttcatttaccgggtattagagtttcacattattccttttcattcat 14281582  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University