View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11546_high_24 (Length: 242)

Name: NF11546_high_24
Description: NF11546
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11546_high_24
NF11546_high_24
[»] chr4 (2 HSPs)
chr4 (1-170)||(40399969-40400138)
chr4 (184-221)||(40400160-40400197)


Alignment Details
Target: chr4 (Bit Score: 162; Significance: 1e-86; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 1 - 170
Target Start/End: Original strand, 40399969 - 40400138
Alignment:
Q  1 tcatgtttatgattatccatgattctgaagtttcaactctcaaccatactatgcatgcagaccatggtccacatcccactaccagagttatggcgggttg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  40399969 tcatgtttatgattatccatgattctgaagtttcaactctcaaccatactatgcatgcagaccatggtccacatcccactaccagagttatggcgggttg 40400068  T
Q  101 acgctgagatttgaggttgaaaatccatgttagtgtttctctaagttactatcatattggtacaaaatgt 170  Q
    |||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
T  40400069 acgctgagatgtgaggttcaaaatccatgttagtgtttctctaagttactatcatattggtacaaaatgt 40400138  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 184 - 221
Target Start/End: Original strand, 40400160 - 40400197
Alignment:
Q  184 ttaagaacgattgatttccgtcgaaaacctataggata 221  Q
    ||||||||||||||||| ||||||||||||||||||||    
T  40400160 ttaagaacgattgattttcgtcgaaaacctataggata 40400197  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University